Journal: Journal of Virology

Article Title: Interferon-Inducible Protein IFI35 Negatively Regulates RIG-I Antiviral Signaling and Supports Vesicular Stomatitis Virus Replication

doi: 10.1128/JVI.03202-13

Figure Lengend Snippet: Primers used in this study

Article Snippet: N-terminally tagged GFP-IRF-3 plasmid was a generous gift from M. U. Gack. pRK5-HA-Ubiquitin-K48 (17605) was purchased from Addgene ( 40 ). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Primer Sequence (5′ to 3′) a Purpose IFI35 KpnI-F ATATAT GGTACC GCCGCCACCATGTCAGCCCCACTGGATG Amplification and cloning of IFI35 in pcDNA vector IFI35 NotI-R ATATAT GCGGCCGC CTAGCCTGACTCAGAGGTG Amplification and cloning of IFI35 in pcDNA vector HAIFI35 KpnI-F ATATAT GGTACC GCCGCCACCATGTACCCATACGATGTTCCAGATTACGCTTCAGCCCCACTGGATGCC Amplification and cloning of HA-tagged IFI35 IFI35 NotI-R ATATAT GCGGCCGC CTAGCCTGACTCAGAGGTG Amplification and cloning of HA-tagged IFI35 VSV P-F GTGACGGACGAATGTCTCATAA Amplification of VSV P mRNA VSV P-R TTTGACTCTCGCCTGATTGTAC Amplification of VSV P mRNA VSV 2795-F GTGACGGACGAATGTCTCATAA Amplification of VSV antigenomic RNA VSV2955-R TGATGAATGGATTGGGATAACA Amplification of VSV antigenomic RNA Actin-F CAAGTACTCCGTGTGTGGAT Amplification of actin mRNA Actin-R CATACTCCTGCTTGCTGAT Amplification of actin mRNA IFN-β-F ATGACCAACAAGTGTCTCCTCC Amplification of IFN-β mRNA IFN-β-R GGAATCCAAGCAAGTTGTAGCTC Amplification of IFN-β mRNA IRF7-F CCCACGCTATACCATCTACCT Amplification of IRF-7 mRNA IRF7-R GATGTCGTCATAGAGGCTGTTG Amplification of IRF-7 mRNA RIG-I-F CTGGACCCTACCTACATCCTG Amplification of RIG-I mRNA RIG-I-R GGCATCCAAAAAGCCACGG Amplification of RIG-I mRNA GAPDH-F GCAAATTCCATGGCACCGT Amplification of GAPDH mRNA GAPDH-R TCGCCCCACTTGATTTTGG Amplification of GAPDH mRNA VSV DI ACGAAGACCACAAAACCAGATAAAAA Amplification of DI RNA RPL32-F GCCAGATCTTATGCCCCAAC Amplification of RPL32 mRNA RPL32-R CGTGCACATGAGCTGCCTAC Amplification of RPL32 mRNA IFI35-F AACAAAAGGAGCACACGATCA Amplification of IFI35 mRNA IFI35-R CTCCGTTCCTAGTCTTGCCAA Amplification of IFI35 mRNA Open in a separate window a Underlined sequences indicate restriction sites.

Techniques: Sequencing, Amplification, Clone Assay, Plasmid Preparation

Journal: Journal of Virology

Article Title: Interferon-Inducible Protein IFI35 Negatively Regulates RIG-I Antiviral Signaling and Supports Vesicular Stomatitis Virus Replication

doi: 10.1128/JVI.03202-13

Figure Lengend Snippet: Depletion of IFI35 inhibits VSV replication. (A) HeLa cells were transfected with 15 nM NT siRNA or increasing amounts (5, 10, and 15 nM) of a combination of two different siRNAs targeting IFI35. At 60 h posttransfection, cells were infected with VSV (MOI = 1) for 4 h. Levels of IFI35 and VSV M were determined by immunoblotting with specific antibodies. Actin served as the loading control. (B) HeLa cells were transfected with 15 nM NT or IFI35 siRNA for 60 h and infected with VSV (MOI = 0.1) for 18 h. Supernatants were harvested, and virus titers were determined by plaque assay and expressed as PFU/ml. Average titers of viruses from NT- and siIFI35-treated cells were 2.7 × 105 and 3.9 × 104 PFU/ml, respectively. (C and D) IFI35 depletion inhibits VSV infection at the levels of virus transcription and replication. HeLa cells were transfected with 15 nM NT or IFI35 targeting siRNA for 60 h. Subsequently, the cells were infected with VSV (MOI = 0.1) for 12 h. VSV P mRNA (C) and VSV antigenomic RNA (D) levels in IFI35-depleted HeLa cells were determined by qRT-PCR. Values were normalized to the internal control β-actin level and expressed as relative changes over the NT sample value, which was set at 100. (E) IFI35 knockdown inhibits VSV DI RNA replication. NPeGFPL stable cells were transfected with 15 nM NT or IFI35 targeting siRNA for 60 h. The cells were then infected with DI particles (DI inf.) for 14 h, and the RNA replication products (both genomic and antigenomic) were quantitated by semiquantitative RT-PCR as described previously (41). IFI35 and RPL32 (internal control) mRNA levels were also examined. Data presented in panels B to D are from three independent experiments, and values represent means and standard deviations (SD) for duplicates. *, P < 0.05; **, P < 0.01.

Article Snippet: N-terminally tagged GFP-IRF-3 plasmid was a generous gift from M. U. Gack. pRK5-HA-Ubiquitin-K48 (17605) was purchased from Addgene ( 40 ). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Primer Sequence (5′ to 3′) a Purpose IFI35 KpnI-F ATATAT GGTACC GCCGCCACCATGTCAGCCCCACTGGATG Amplification and cloning of IFI35 in pcDNA vector IFI35 NotI-R ATATAT GCGGCCGC CTAGCCTGACTCAGAGGTG Amplification and cloning of IFI35 in pcDNA vector HAIFI35 KpnI-F ATATAT GGTACC GCCGCCACCATGTACCCATACGATGTTCCAGATTACGCTTCAGCCCCACTGGATGCC Amplification and cloning of HA-tagged IFI35 IFI35 NotI-R ATATAT GCGGCCGC CTAGCCTGACTCAGAGGTG Amplification and cloning of HA-tagged IFI35 VSV P-F GTGACGGACGAATGTCTCATAA Amplification of VSV P mRNA VSV P-R TTTGACTCTCGCCTGATTGTAC Amplification of VSV P mRNA VSV 2795-F GTGACGGACGAATGTCTCATAA Amplification of VSV antigenomic RNA VSV2955-R TGATGAATGGATTGGGATAACA Amplification of VSV antigenomic RNA Actin-F CAAGTACTCCGTGTGTGGAT Amplification of actin mRNA Actin-R CATACTCCTGCTTGCTGAT Amplification of actin mRNA IFN-β-F ATGACCAACAAGTGTCTCCTCC Amplification of IFN-β mRNA IFN-β-R GGAATCCAAGCAAGTTGTAGCTC Amplification of IFN-β mRNA IRF7-F CCCACGCTATACCATCTACCT Amplification of IRF-7 mRNA IRF7-R GATGTCGTCATAGAGGCTGTTG Amplification of IRF-7 mRNA RIG-I-F CTGGACCCTACCTACATCCTG Amplification of RIG-I mRNA RIG-I-R GGCATCCAAAAAGCCACGG Amplification of RIG-I mRNA GAPDH-F GCAAATTCCATGGCACCGT Amplification of GAPDH mRNA GAPDH-R TCGCCCCACTTGATTTTGG Amplification of GAPDH mRNA VSV DI ACGAAGACCACAAAACCAGATAAAAA Amplification of DI RNA RPL32-F GCCAGATCTTATGCCCCAAC Amplification of RPL32 mRNA RPL32-R CGTGCACATGAGCTGCCTAC Amplification of RPL32 mRNA IFI35-F AACAAAAGGAGCACACGATCA Amplification of IFI35 mRNA IFI35-R CTCCGTTCCTAGTCTTGCCAA Amplification of IFI35 mRNA Open in a separate window a Underlined sequences indicate restriction sites.

Techniques: Transfection, Infection, Western Blot, Plaque Assay, Quantitative RT-PCR, Reverse Transcription Polymerase Chain Reaction

Journal: Journal of Virology

Article Title: Interferon-Inducible Protein IFI35 Negatively Regulates RIG-I Antiviral Signaling and Supports Vesicular Stomatitis Virus Replication

doi: 10.1128/JVI.03202-13

Figure Lengend Snippet: IFI35 rescues VSV infection by negatively regulating host antiviral response. (A and B) IFI35 downregulates IFN-β mRNA synthesis. EV and 3xF-IFI35 stable cells (A) or HEK293 cells transfected with NT or IFI35 siRNA (B) were infected with SeV for 16 h. Total RNA was isolated, and IFN-β mRNA was quantified by qRT-PCR. Values were normalized to the internal control (glyceraldehyde-3-phosphate dehydrogenase [GAPDH]) and expressed as relative fold changes over the mock-infected NT or EV sample value, which was set at 1. Values represent means and SD for duplicate reactions from two independent experiments. **, P < 0.01. (C) IFI35 overexpression suppresses ISG56 induction. EV and 3xF-IFI35 stable cells were infected with SeV for 16 h. Cell lysates were used for immunoblotting using ISG56, Flag M2 (detects 3xF-IFI35), and actin antibodies. (D) IFI35 overexpression rescues poly(I·C)-induced suppression of VSV infection. EV and 3xF-IFI35 cells were transfected with 2 μg poly(I·C) for 16 h and infected with VSV (MOI = 0.1) for 18 h. The supernatants were harvested, and virus titers were determined by plaque assay on BHK-21 cells. Virus titers are expressed as log10 PFU/ml. Values represent means and SD for three independent experiments. **, P < 0.01.

Article Snippet: N-terminally tagged GFP-IRF-3 plasmid was a generous gift from M. U. Gack. pRK5-HA-Ubiquitin-K48 (17605) was purchased from Addgene ( 40 ). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Primer Sequence (5′ to 3′) a Purpose IFI35 KpnI-F ATATAT GGTACC GCCGCCACCATGTCAGCCCCACTGGATG Amplification and cloning of IFI35 in pcDNA vector IFI35 NotI-R ATATAT GCGGCCGC CTAGCCTGACTCAGAGGTG Amplification and cloning of IFI35 in pcDNA vector HAIFI35 KpnI-F ATATAT GGTACC GCCGCCACCATGTACCCATACGATGTTCCAGATTACGCTTCAGCCCCACTGGATGCC Amplification and cloning of HA-tagged IFI35 IFI35 NotI-R ATATAT GCGGCCGC CTAGCCTGACTCAGAGGTG Amplification and cloning of HA-tagged IFI35 VSV P-F GTGACGGACGAATGTCTCATAA Amplification of VSV P mRNA VSV P-R TTTGACTCTCGCCTGATTGTAC Amplification of VSV P mRNA VSV 2795-F GTGACGGACGAATGTCTCATAA Amplification of VSV antigenomic RNA VSV2955-R TGATGAATGGATTGGGATAACA Amplification of VSV antigenomic RNA Actin-F CAAGTACTCCGTGTGTGGAT Amplification of actin mRNA Actin-R CATACTCCTGCTTGCTGAT Amplification of actin mRNA IFN-β-F ATGACCAACAAGTGTCTCCTCC Amplification of IFN-β mRNA IFN-β-R GGAATCCAAGCAAGTTGTAGCTC Amplification of IFN-β mRNA IRF7-F CCCACGCTATACCATCTACCT Amplification of IRF-7 mRNA IRF7-R GATGTCGTCATAGAGGCTGTTG Amplification of IRF-7 mRNA RIG-I-F CTGGACCCTACCTACATCCTG Amplification of RIG-I mRNA RIG-I-R GGCATCCAAAAAGCCACGG Amplification of RIG-I mRNA GAPDH-F GCAAATTCCATGGCACCGT Amplification of GAPDH mRNA GAPDH-R TCGCCCCACTTGATTTTGG Amplification of GAPDH mRNA VSV DI ACGAAGACCACAAAACCAGATAAAAA Amplification of DI RNA RPL32-F GCCAGATCTTATGCCCCAAC Amplification of RPL32 mRNA RPL32-R CGTGCACATGAGCTGCCTAC Amplification of RPL32 mRNA IFI35-F AACAAAAGGAGCACACGATCA Amplification of IFI35 mRNA IFI35-R CTCCGTTCCTAGTCTTGCCAA Amplification of IFI35 mRNA Open in a separate window a Underlined sequences indicate restriction sites.

Techniques: Infection, Transfection, Isolation, Quantitative RT-PCR, Over Expression, Western Blot, Plaque Assay

Journal: Journal of Virology

Article Title: Interferon-Inducible Protein IFI35 Negatively Regulates RIG-I Antiviral Signaling and Supports Vesicular Stomatitis Virus Replication

doi: 10.1128/JVI.03202-13

Figure Lengend Snippet: IFI35 attenuates IFN-β activation and signaling. (A and B) Effect of IFI35 on IFN-β promoter activation. (A) HEK293 cells were transfected with 15 nM NT or IFI35 targeting siRNA for a total of 76 h. After the first 24 h, cells were transfected with 500 ng of IFN-β luciferase reporter plasmid (IFNβ-Luc) along with 50 ng of pRL-TK plasmid and were incubated for another 36 h. For the final 16 h prior to harvesting, cells were either mock infected or infected with SeV. Cell lysates were used for dual-luciferase assay. (B) EV and 3xF-IFI35 stable cells were transfected with 500 ng of IFN-β luciferase reporter plasmid along with 50 ng of pRL-TK plasmid for 32 h. Subsequently, cells were infected with SeV for 16 h, and cell lysates were used for dual-luciferase assay. (C and D) Effect of IFI35 on NF-κB promoter activation. Experimental conditions were similar to those for panels A and B, except that 500 ng of NF-κB luciferase construct (NF-κB-Luc) was transfected in place of IFNβ-Luc. (E and F) Effect of IFI35 on ISG56 promoter activation. Experimental conditions were similar to those for panels A and B, except that 500 ng of ISG56 luciferase construct (ISG56-Luc) was transfected in place of the IFNβ-Luc construct. Values presented in all the promoter reporter assays are normalized to NT or EV control cells and expressed as relative fold changes over the mock-infected NT or EV sample value, which was set at 1. Values represent means and SD for three independent experiments. *, P < 0.05; **, P < 0.01.

Article Snippet: N-terminally tagged GFP-IRF-3 plasmid was a generous gift from M. U. Gack. pRK5-HA-Ubiquitin-K48 (17605) was purchased from Addgene ( 40 ). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Primer Sequence (5′ to 3′) a Purpose IFI35 KpnI-F ATATAT GGTACC GCCGCCACCATGTCAGCCCCACTGGATG Amplification and cloning of IFI35 in pcDNA vector IFI35 NotI-R ATATAT GCGGCCGC CTAGCCTGACTCAGAGGTG Amplification and cloning of IFI35 in pcDNA vector HAIFI35 KpnI-F ATATAT GGTACC GCCGCCACCATGTACCCATACGATGTTCCAGATTACGCTTCAGCCCCACTGGATGCC Amplification and cloning of HA-tagged IFI35 IFI35 NotI-R ATATAT GCGGCCGC CTAGCCTGACTCAGAGGTG Amplification and cloning of HA-tagged IFI35 VSV P-F GTGACGGACGAATGTCTCATAA Amplification of VSV P mRNA VSV P-R TTTGACTCTCGCCTGATTGTAC Amplification of VSV P mRNA VSV 2795-F GTGACGGACGAATGTCTCATAA Amplification of VSV antigenomic RNA VSV2955-R TGATGAATGGATTGGGATAACA Amplification of VSV antigenomic RNA Actin-F CAAGTACTCCGTGTGTGGAT Amplification of actin mRNA Actin-R CATACTCCTGCTTGCTGAT Amplification of actin mRNA IFN-β-F ATGACCAACAAGTGTCTCCTCC Amplification of IFN-β mRNA IFN-β-R GGAATCCAAGCAAGTTGTAGCTC Amplification of IFN-β mRNA IRF7-F CCCACGCTATACCATCTACCT Amplification of IRF-7 mRNA IRF7-R GATGTCGTCATAGAGGCTGTTG Amplification of IRF-7 mRNA RIG-I-F CTGGACCCTACCTACATCCTG Amplification of RIG-I mRNA RIG-I-R GGCATCCAAAAAGCCACGG Amplification of RIG-I mRNA GAPDH-F GCAAATTCCATGGCACCGT Amplification of GAPDH mRNA GAPDH-R TCGCCCCACTTGATTTTGG Amplification of GAPDH mRNA VSV DI ACGAAGACCACAAAACCAGATAAAAA Amplification of DI RNA RPL32-F GCCAGATCTTATGCCCCAAC Amplification of RPL32 mRNA RPL32-R CGTGCACATGAGCTGCCTAC Amplification of RPL32 mRNA IFI35-F AACAAAAGGAGCACACGATCA Amplification of IFI35 mRNA IFI35-R CTCCGTTCCTAGTCTTGCCAA Amplification of IFI35 mRNA Open in a separate window a Underlined sequences indicate restriction sites.

Techniques: Activation Assay, Transfection, Luciferase, Plasmid Preparation, Incubation, Infection, Construct

Journal: Journal of Virology

Article Title: Interferon-Inducible Protein IFI35 Negatively Regulates RIG-I Antiviral Signaling and Supports Vesicular Stomatitis Virus Replication

doi: 10.1128/JVI.03202-13

Figure Lengend Snippet: IFI35 downregulates activation of IRF-3 and IRF-7. (A and B) IFI35 downregulates IRF-3 phosphorylation. (A) HEK293 cells were transfected with 15 nM NT or IFI35 siRNA for 60 h and infected with SeV for another 16 h. Cell lysates were analyzed by immunoblotting using the indicated antibodies. (B) EV and 3xF-IFI35 stable cells were infected with SeV for 16 h, and cell lysates were analyzed by immunoblotting using the indicated antibodies. (C) IFI35 overexpression inhibits nuclear translocation of IRF-3. EV and 3xF-IFI35 stable cells were grown on coverslips, transfected with 1 μg GFP-IRF-3 plasmid for 32 h, and then infected with SeV for 16 h. 3xF-IFI35 was immunostained using anti-Flag antibody. Nuclei were stained with DAPI. (D and E) IFI35 downregulates IRF-7 induction. (D) HEK293 cells were transfected with 15 nM NT or IFI35 siRNA for 60 h and infected with SeV for another 16 h. Total RNA was isolated and subjected to qRT-PCR using IRF-7-specific primers. (E) IRF-7 mRNA was quantified as described for panel D, using EV and 3xF-IFI35 stable cells infected with SeV for 16 h. Values were normalized to the internal control GAPDH value and expressed as relative fold changes over the mock-infected EV or NT sample value, which was set at 1. Values represent means and SD for duplicate reactions from two independent experiments. *, P < 0.05.

Article Snippet: N-terminally tagged GFP-IRF-3 plasmid was a generous gift from M. U. Gack. pRK5-HA-Ubiquitin-K48 (17605) was purchased from Addgene ( 40 ). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Primer Sequence (5′ to 3′) a Purpose IFI35 KpnI-F ATATAT GGTACC GCCGCCACCATGTCAGCCCCACTGGATG Amplification and cloning of IFI35 in pcDNA vector IFI35 NotI-R ATATAT GCGGCCGC CTAGCCTGACTCAGAGGTG Amplification and cloning of IFI35 in pcDNA vector HAIFI35 KpnI-F ATATAT GGTACC GCCGCCACCATGTACCCATACGATGTTCCAGATTACGCTTCAGCCCCACTGGATGCC Amplification and cloning of HA-tagged IFI35 IFI35 NotI-R ATATAT GCGGCCGC CTAGCCTGACTCAGAGGTG Amplification and cloning of HA-tagged IFI35 VSV P-F GTGACGGACGAATGTCTCATAA Amplification of VSV P mRNA VSV P-R TTTGACTCTCGCCTGATTGTAC Amplification of VSV P mRNA VSV 2795-F GTGACGGACGAATGTCTCATAA Amplification of VSV antigenomic RNA VSV2955-R TGATGAATGGATTGGGATAACA Amplification of VSV antigenomic RNA Actin-F CAAGTACTCCGTGTGTGGAT Amplification of actin mRNA Actin-R CATACTCCTGCTTGCTGAT Amplification of actin mRNA IFN-β-F ATGACCAACAAGTGTCTCCTCC Amplification of IFN-β mRNA IFN-β-R GGAATCCAAGCAAGTTGTAGCTC Amplification of IFN-β mRNA IRF7-F CCCACGCTATACCATCTACCT Amplification of IRF-7 mRNA IRF7-R GATGTCGTCATAGAGGCTGTTG Amplification of IRF-7 mRNA RIG-I-F CTGGACCCTACCTACATCCTG Amplification of RIG-I mRNA RIG-I-R GGCATCCAAAAAGCCACGG Amplification of RIG-I mRNA GAPDH-F GCAAATTCCATGGCACCGT Amplification of GAPDH mRNA GAPDH-R TCGCCCCACTTGATTTTGG Amplification of GAPDH mRNA VSV DI ACGAAGACCACAAAACCAGATAAAAA Amplification of DI RNA RPL32-F GCCAGATCTTATGCCCCAAC Amplification of RPL32 mRNA RPL32-R CGTGCACATGAGCTGCCTAC Amplification of RPL32 mRNA IFI35-F AACAAAAGGAGCACACGATCA Amplification of IFI35 mRNA IFI35-R CTCCGTTCCTAGTCTTGCCAA Amplification of IFI35 mRNA Open in a separate window a Underlined sequences indicate restriction sites.

Techniques: Activation Assay, Transfection, Infection, Western Blot, Over Expression, Translocation Assay, Plasmid Preparation, Staining, Isolation, Quantitative RT-PCR

Journal: Journal of Virology

Article Title: Interferon-Inducible Protein IFI35 Negatively Regulates RIG-I Antiviral Signaling and Supports Vesicular Stomatitis Virus Replication

doi: 10.1128/JVI.03202-13

Figure Lengend Snippet: IFI35 negatively regulates RIG-I pathway activation. (A) EV and 3xF-IFI35 stable cells were transfected with a plasmid encoding the RIG-I pathway components (0.5 μg each) MAVS, TBK1, RIG-I, or N-RIG-I, along with 0.25 μg IFNβ-Luc and 0.025 μg pRL-TK plasmid, for 48 h. The cells were lysed and used for dual-luciferase assays. (B) HEK293 cells were transfected with 15 nM NT or IFI35 siRNA for 24 h and then transfected for another 48 h with plasmids as described for panel A. Cells were lysed and used for dual-luciferase assays. Luciferase values were normalized to the EV or NT control cells and expressed as relative fold changes over the mock-infected EV or NT sample value, which was set at 1. Values represent means and SD for two independent experiments performed in duplicate. *, P < 0.05; **, P < 0.01; ns, not significant. (C and D) IFI35 negatively regulates RIG-I activation. (C) HEK293 cells were transfected with 15 nM NT or IFI35 siRNA for 60 h and infected with SeV for another 16 h. The cells were treated with 100 nM calyculin A for 30 min before harvesting. Cell lysates were analyzed by immunoblotting using the indicated antibodies. Actin served as a loading control. (D) EV and 3xF-IFI35 stable cells were infected with SeV for 16 h and processed as described for panel C. (E and F) Knockdown or overexpression of IFI35 enhances or suppresses RIG-I transcription, respectively. (E) HEK293 cells were transfected with 15 nM NT or IFI35 siRNA for 60 h and infected with SeV for another 16 h. Total RNA was isolated and used for quantification of RIG-I mRNA levels by qRT-PCR. (F) EV or 3xF-IFI35 stable cells were infected with SeV for 16 h and processed as described for panel E. Values were normalized to the internal control GAPDH level and expressed as relative fold changes over the mock-infected EV or NT sample value, which was set at 1. **, P < 0.01.

Article Snippet: N-terminally tagged GFP-IRF-3 plasmid was a generous gift from M. U. Gack. pRK5-HA-Ubiquitin-K48 (17605) was purchased from Addgene ( 40 ). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Primer Sequence (5′ to 3′) a Purpose IFI35 KpnI-F ATATAT GGTACC GCCGCCACCATGTCAGCCCCACTGGATG Amplification and cloning of IFI35 in pcDNA vector IFI35 NotI-R ATATAT GCGGCCGC CTAGCCTGACTCAGAGGTG Amplification and cloning of IFI35 in pcDNA vector HAIFI35 KpnI-F ATATAT GGTACC GCCGCCACCATGTACCCATACGATGTTCCAGATTACGCTTCAGCCCCACTGGATGCC Amplification and cloning of HA-tagged IFI35 IFI35 NotI-R ATATAT GCGGCCGC CTAGCCTGACTCAGAGGTG Amplification and cloning of HA-tagged IFI35 VSV P-F GTGACGGACGAATGTCTCATAA Amplification of VSV P mRNA VSV P-R TTTGACTCTCGCCTGATTGTAC Amplification of VSV P mRNA VSV 2795-F GTGACGGACGAATGTCTCATAA Amplification of VSV antigenomic RNA VSV2955-R TGATGAATGGATTGGGATAACA Amplification of VSV antigenomic RNA Actin-F CAAGTACTCCGTGTGTGGAT Amplification of actin mRNA Actin-R CATACTCCTGCTTGCTGAT Amplification of actin mRNA IFN-β-F ATGACCAACAAGTGTCTCCTCC Amplification of IFN-β mRNA IFN-β-R GGAATCCAAGCAAGTTGTAGCTC Amplification of IFN-β mRNA IRF7-F CCCACGCTATACCATCTACCT Amplification of IRF-7 mRNA IRF7-R GATGTCGTCATAGAGGCTGTTG Amplification of IRF-7 mRNA RIG-I-F CTGGACCCTACCTACATCCTG Amplification of RIG-I mRNA RIG-I-R GGCATCCAAAAAGCCACGG Amplification of RIG-I mRNA GAPDH-F GCAAATTCCATGGCACCGT Amplification of GAPDH mRNA GAPDH-R TCGCCCCACTTGATTTTGG Amplification of GAPDH mRNA VSV DI ACGAAGACCACAAAACCAGATAAAAA Amplification of DI RNA RPL32-F GCCAGATCTTATGCCCCAAC Amplification of RPL32 mRNA RPL32-R CGTGCACATGAGCTGCCTAC Amplification of RPL32 mRNA IFI35-F AACAAAAGGAGCACACGATCA Amplification of IFI35 mRNA IFI35-R CTCCGTTCCTAGTCTTGCCAA Amplification of IFI35 mRNA Open in a separate window a Underlined sequences indicate restriction sites.

Techniques: Activation Assay, Transfection, Plasmid Preparation, Luciferase, Infection, Western Blot, Over Expression, Isolation, Quantitative RT-PCR

Journal: Journal of Virology

Article Title: Interferon-Inducible Protein IFI35 Negatively Regulates RIG-I Antiviral Signaling and Supports Vesicular Stomatitis Virus Replication

doi: 10.1128/JVI.03202-13

Figure Lengend Snippet: IFI35 interacts with and promotes degradation of RIG-I via K48-linked ubiquitination. (A) SeV infection enhances colocalization of IFI35 and RIG-I. HEK293 cells were grown on coverslips and mock infected or infected with SeV for 16 h. The cells were fixed and immunostained with the indicated antibodies. Nuclei were stained with DAPI, and images were collected at a magnification of ×60. (B) IFI35 interacts with RIG-I in transfected cells. HEK293 cells were transfected with 0.5 μg (each) of the indicated plasmids for 32 h. One set of cells was mock infected, while the other set was infected with SeV for another 16 h. Co-IP and immunoblotting (IB) were performed with the indicated antibodies. Expression of proteins from the transfected plasmids was analyzed in the whole-cell lysates (WCL) by using the indicated antibodies. (C) IFI35 promotes proteasomal degradation of RIG-I. Sets of HEK293 cells were transfected with 0.5 μg of Flag-RIG-I along with increasing amounts of IFI35 (0.5 and 1 μg) for 36 h. One set of cells was treated with 10 μM MG132 and the other set with DMSO for 12 h. Cell lysates were analyzed by immunoblotting with the indicated antibodies. (D) IFI35 overexpression enhances K48-linked ubiquitination of RIG-I. Sets of HEK293 cells were transfected with Flag-RIG-I and HA-Ub-K48 constructs (0.5 μg [each]) along with increasing amounts of plasmid expressing IFI35 (0.5, 1, and 2 μg) for 36 h. One set of cells was treated with MG132 (10 μM) for 12 h and subsequently lysed and used for co-IP and immunoblotting with the indicated antibodies. Another set of cells was treated with DMSO for 12 h, and the whole-cell lysates were analyzed by immunoblotting with the indicated antibodies. (E) IFI35 knockdown reduces K48-linked ubiquitination of RIG-I. Sets of HEK293 cells were transfected with NT siRNA or increasing amounts of IFI35 siRNA (5, 10, and 20 nM) for 24 h. The cells were transfected with Flag-RIG-I and HA-Ubiquitin-K48 constructs (0.5 μg [each]) for another 36 h. Cells were subsequently processed as described for panel D.

Article Snippet: N-terminally tagged GFP-IRF-3 plasmid was a generous gift from M. U. Gack. pRK5-HA-Ubiquitin-K48 (17605) was purchased from Addgene ( 40 ). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Primer Sequence (5′ to 3′) a Purpose IFI35 KpnI-F ATATAT GGTACC GCCGCCACCATGTCAGCCCCACTGGATG Amplification and cloning of IFI35 in pcDNA vector IFI35 NotI-R ATATAT GCGGCCGC CTAGCCTGACTCAGAGGTG Amplification and cloning of IFI35 in pcDNA vector HAIFI35 KpnI-F ATATAT GGTACC GCCGCCACCATGTACCCATACGATGTTCCAGATTACGCTTCAGCCCCACTGGATGCC Amplification and cloning of HA-tagged IFI35 IFI35 NotI-R ATATAT GCGGCCGC CTAGCCTGACTCAGAGGTG Amplification and cloning of HA-tagged IFI35 VSV P-F GTGACGGACGAATGTCTCATAA Amplification of VSV P mRNA VSV P-R TTTGACTCTCGCCTGATTGTAC Amplification of VSV P mRNA VSV 2795-F GTGACGGACGAATGTCTCATAA Amplification of VSV antigenomic RNA VSV2955-R TGATGAATGGATTGGGATAACA Amplification of VSV antigenomic RNA Actin-F CAAGTACTCCGTGTGTGGAT Amplification of actin mRNA Actin-R CATACTCCTGCTTGCTGAT Amplification of actin mRNA IFN-β-F ATGACCAACAAGTGTCTCCTCC Amplification of IFN-β mRNA IFN-β-R GGAATCCAAGCAAGTTGTAGCTC Amplification of IFN-β mRNA IRF7-F CCCACGCTATACCATCTACCT Amplification of IRF-7 mRNA IRF7-R GATGTCGTCATAGAGGCTGTTG Amplification of IRF-7 mRNA RIG-I-F CTGGACCCTACCTACATCCTG Amplification of RIG-I mRNA RIG-I-R GGCATCCAAAAAGCCACGG Amplification of RIG-I mRNA GAPDH-F GCAAATTCCATGGCACCGT Amplification of GAPDH mRNA GAPDH-R TCGCCCCACTTGATTTTGG Amplification of GAPDH mRNA VSV DI ACGAAGACCACAAAACCAGATAAAAA Amplification of DI RNA RPL32-F GCCAGATCTTATGCCCCAAC Amplification of RPL32 mRNA RPL32-R CGTGCACATGAGCTGCCTAC Amplification of RPL32 mRNA IFI35-F AACAAAAGGAGCACACGATCA Amplification of IFI35 mRNA IFI35-R CTCCGTTCCTAGTCTTGCCAA Amplification of IFI35 mRNA Open in a separate window a Underlined sequences indicate restriction sites.

Techniques: Infection, Staining, Transfection, Co-Immunoprecipitation Assay, Western Blot, Expressing, Over Expression, Construct, Plasmid Preparation

Journal: Journal of Virology

Article Title: Interferon-Inducible Protein IFI35 Negatively Regulates RIG-I Antiviral Signaling and Supports Vesicular Stomatitis Virus Replication

doi: 10.1128/JVI.03202-13

Figure Lengend Snippet: Proposed model depicting the role of IFI35 in negative regulation of RIG-I signaling. For the sake of simplicity, we show only the ubiquitin-mediated degradation pathway. Viruses such as VSV and SeV are recognized by RIG-I, which signals through downstream factors (IRF-3/IRF-7) leading to production of type I IFNs (IFN-α/β). IFN-α/β in turn induce the synthesis of ISGs, including IFI35, which interacts with RIG-I and inhibits its activation by promoting K48-linked ubiquitination and proteasomal degradation. The identity of the associated E3 ubiquitin ligase is unknown at this time. The negative-feedback loop mediated by IFI35 leads to downregulation of the host antiviral response.

Article Snippet: N-terminally tagged GFP-IRF-3 plasmid was a generous gift from M. U. Gack. pRK5-HA-Ubiquitin-K48 (17605) was purchased from Addgene ( 40 ). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Primer Sequence (5′ to 3′) a Purpose IFI35 KpnI-F ATATAT GGTACC GCCGCCACCATGTCAGCCCCACTGGATG Amplification and cloning of IFI35 in pcDNA vector IFI35 NotI-R ATATAT GCGGCCGC CTAGCCTGACTCAGAGGTG Amplification and cloning of IFI35 in pcDNA vector HAIFI35 KpnI-F ATATAT GGTACC GCCGCCACCATGTACCCATACGATGTTCCAGATTACGCTTCAGCCCCACTGGATGCC Amplification and cloning of HA-tagged IFI35 IFI35 NotI-R ATATAT GCGGCCGC CTAGCCTGACTCAGAGGTG Amplification and cloning of HA-tagged IFI35 VSV P-F GTGACGGACGAATGTCTCATAA Amplification of VSV P mRNA VSV P-R TTTGACTCTCGCCTGATTGTAC Amplification of VSV P mRNA VSV 2795-F GTGACGGACGAATGTCTCATAA Amplification of VSV antigenomic RNA VSV2955-R TGATGAATGGATTGGGATAACA Amplification of VSV antigenomic RNA Actin-F CAAGTACTCCGTGTGTGGAT Amplification of actin mRNA Actin-R CATACTCCTGCTTGCTGAT Amplification of actin mRNA IFN-β-F ATGACCAACAAGTGTCTCCTCC Amplification of IFN-β mRNA IFN-β-R GGAATCCAAGCAAGTTGTAGCTC Amplification of IFN-β mRNA IRF7-F CCCACGCTATACCATCTACCT Amplification of IRF-7 mRNA IRF7-R GATGTCGTCATAGAGGCTGTTG Amplification of IRF-7 mRNA RIG-I-F CTGGACCCTACCTACATCCTG Amplification of RIG-I mRNA RIG-I-R GGCATCCAAAAAGCCACGG Amplification of RIG-I mRNA GAPDH-F GCAAATTCCATGGCACCGT Amplification of GAPDH mRNA GAPDH-R TCGCCCCACTTGATTTTGG Amplification of GAPDH mRNA VSV DI ACGAAGACCACAAAACCAGATAAAAA Amplification of DI RNA RPL32-F GCCAGATCTTATGCCCCAAC Amplification of RPL32 mRNA RPL32-R CGTGCACATGAGCTGCCTAC Amplification of RPL32 mRNA IFI35-F AACAAAAGGAGCACACGATCA Amplification of IFI35 mRNA IFI35-R CTCCGTTCCTAGTCTTGCCAA Amplification of IFI35 mRNA Open in a separate window a Underlined sequences indicate restriction sites.

Techniques: Activation Assay